Sony WPSD5 Surround Sound System “repair” Notes

sony_sur

I was offered a broken WPSD5 Surround Sound system and of course snapped it up. A couple of weeks back someone also offered me a working one but I turned it down. Positioning all those speakers felt like too much for an audio-luddite like me. But a broken one… well that’s an adventure!

While economically un-viable repairing broken consumer electronics gives an interesting insight into the design discussions taken. And for someone like myself who isn’t an experienced EE, wandering through the schematics teaches me all sorts of things. Gratifyingly a service manual is available with both detailed schematics and a overall block diagram:

sony_blockdiaWorryingly the digital side is built about a proprietary microcontroller (IC701). The microcontroller is powered by EVER+5.6V which comes off the main power supply and is always up. Other supply voltages (for the analogue section) are brought up by the microcontroller on soft power on.

The microcontroller itself however doesn’t do very much, it just brings up the system and controls the surround sound DAC. The DAC is an AK4527, for which a datasheet is readily available. This is a fun part, it’s a I2C controlled surround sound synthesizer. It includes ADCs to sample analogue input or can also accept digital signals (S/PDIF via some external ICs). Analogue signals head out of this IC and out of the digital board toward the analogue section.

On the analogue board we find 3 TA2022 power amplifiers. These are 2 channel 90W “class-T” amplifiers. Class-T is Tripaths proprietary, switching, class-D amplifier implementation. The TA2020 from this series was listed as one of the 25 microchips that shook the world. It was my first time encountering class-D amps and it was interesting reviewing this part of the design. A datasheet for the ta2022  is also available, and TA2022 modules can be found on eBay easily for about 15USD. They look like fun modules and I’ve seen a number of amateur projects using them.

So… on my system the fault signal was being asserted, by this funky transistor network:

faultThat signaled a fault to the microcontroller, which in turn stopped the main powersupply from coming up and didn’t enable the relays on the speaker outputs so you wouldn’t be able to hear anything anyway. In order to debug further I need to get the amplifiers to come up. I removed the digital board and started digging around.

First of all, you can pull pin 16 (POWER) on CN123 to +4.7V DIRECT (which is also always up). That switches IC906 on. This is a regulator (datasheet) which generates a bunch of supply voltages. I then shorted Q394 which is the transistor controlling the output relays. The amplifiers where still muted (controlled via AMP-MUTE) so I pulled AMP-MUTE high (I think using +4.7V DIRECT again) to turn them out.

In debugging the system I found that 2 of the amplifier ICs weren’t coming up. The TA2022s have built in fault detection and 2 of them were muting themselves. The layout of the 3 TA2022s the largely identical, IC301 however does also generate a reference signal that is fed to the other two:

amps

Strangely the system doesn’t used the HMUTE signal from the TA2022s but has additional fault detection circuitry, and this was causing the fault signal that was being sent to the microcontroller. The TA2022s own fault detection circuitry was also firing however. This is basically where my debugging stopped. I would likely continue by replacing the TA2022s, but it wasn’t worth it for me.

Now… what I’ve actually been wanting is a cheap 2 channel stereo speaker system. So I hacked a 3.5mm stereo jack on to the input of the analogue board and am using the surround sound system as a stereo speaker set. I’m just using a couple of the satellite speakers. This is probably a pretty awful thing to do, I’d guess they don’t produce low frequencies particularly well, but it sounds fine to me and is and order of magnitude better than my laptop speakers so I’m happy… I also had an interesting adventure and learned a lot about how consumer Hi-Fi equipment is put together.

A Note On The Ion Torrent Flow Order

The Ion torrent DNA sequencers don’t just flow in A,T,G and C bases in a 4base cycle but use a more complex 32bp flow order. I was trying to figure out exactly what was going on and found this comment on the ioncommunity forum which somewhat explains what’s going on. Here’s the flow order they use (32 bases long!):

TACGTACGTCTGAGCATCGATCGATGTACAGC

The 32 base sequence, is composed of 2 16bp sub-sequences. These subsequences have the same structure but the bases are transposed. The 16bp sequences contain one flow of every base followed by every 2bp combination [1]. In the general case a string containing every possible substring of length k exactly once is called a de Bruijn sequence [2].

Why they do this is less clear, it might be that hitting bases in order assists with phasing or other characteristic errors. It’s also possible that there are other aspects of the base flow order that improve the sequencing process.

[1] The following is a verification of the statement above:

Original Sequence: TACGTACGTCTGAGCATCGATCGATGTACAGC

The following are the 16bp sequences, below these I’ve labelled each base by the position it first occurs in the sequence. These patterns are identical. The conclusion is that if you swap A with C, and swap C with G you can change the first sequence into the second:

TACGTACGTCTGAGCA
1234123413142432

TCGATCGATGTACAGC
1234123413142432

Taking the 12bp sequence, you can see that it contains every 2bp combination exactly one:

TACGTCTGAGCA
new@navlaptop:~/biotech/dnae/floworder$ ./a.out | sort | uniq -c
1 AC
1 AG
1 CA
1 CG
1 CT
1 GA
1 GC
1 GT
1 TA
1 TC
1 TG

[2] https://en.wikipedia.org/wiki/De_Bruijn_sequence

Inside a cheap bubble blowing toy

IMG_0165 2

My wife picked up a cheap (6USD) bubble blowing toy. Ever since we got it I’ve been at least as fascinated by it as our child. Perhaps slightly less enamoured with the repetitive melody it produces however.

As always though, I find it amazingly how much they pack into these cheap mass produced consumer products and the corners that get cut to reduce costs.

What particularly interested me was that it uses a peristaltic pump to push the soap mix toward what I call the “bubble formation aperture”. I’ve been reading about peristaltic pumps recently because they’re often used to deliver accurate volumes of liquid for scientific and medical applications.

Peristaltic_pump

The pump is named after the contractions the intestine makes to push food through your digestive tract and it operates in the same way. The gif to the left (shamelessly stolen from the wikipedia page), shows how fluid is pushed along.

This toy uses this exact mechanism, because it’s transparent you can see the pump operating without taking the toy apart which is also pretty neat and a nice learning aid. The gif below shows the toy operating and you can clearly see the pump working away.

bubbletoy

IMG_0177In order to create bubbles the toy needs not only to deliver the fluid in a controlled manner and allow it to form a film, but to force air through the film in order to create bubbles. This uses the simple (but I still think rather nicely designed) fan assembly shown to the right.

Both the fan and the pump are driven by the same motor. This is a dual shaft motor, which looks something like this:

dualshaftIn order to keeps costs low the toy uses a couple of other neat tricks. The first is the usual ultra-cheap PCBs that are used in these kinds of toys. Single layer and massless. Rather than being CNC routed out I’ve heard these are punched out, given than normal PCBs cost almost nothing, these must be practically free. Again, as is common it uses a dye on PCB with a blob of epoxy on it. This actually isn’t required for the general operation of the toy, it’s only used to synthesise the annoying music the toy produces (and flash the LEDs).
IMG_0168

One final trick is the omission of any kind of power switch. The trigger just has a spring connected to it. The battery ground is connected to this spring and when the trigger is press it shorts against the motor chassis to complete the circuit. That’s a serious hack to avoid a real switch or an extra metal plate. But when the product costs 6USD and I would imagine an order of magnitude less to manufacture. Every penny must count.

 

 

 

 

 

 

 

 

Update

FullSizeRenderI’m impressed by how robust the toy is. Even though it’s in no way water tight it’s still operational after being fully submerged. The rear LED failed but everything else works. I put this down to the simplicity of the electronics and the fact that the IC is enclosed in resin. But it looks the motor housing maybe more or less water tight. Pretty impressive in any case.

Genia’s pore insertion technqiue

In my previous post on the new Genia paper, I mentioned the following quote from their paper: “The applied voltage is adjusted to ensure that, in a majority of cases, one and only one pore is inserted into the membranes of each well.”. It’s a one line note, but it intrigued me. First, a little background on why this is a moderately interesting development.

In general protein nanopores insert themselves into bilayers. No applied voltage or particularly special conditions are required for this, it is after all the purpose for which they have evolved. There is of course nothing to stop them from inserting multiple times into the same bilayer, and for sequencing that causes issues. The cartoon below show the signal from an ideal single nanopore:

singlepore

Great! A nice clean signal. But if we have two pores inserted, as well as a shifted baseline we get a signal that much harder to interpret and can not be basecalled:

twoporesactive

Nanopore based sequencers have in general addressed this by throwing channels at the problem and assuming that you’ll only get 37% of the wells occupied by a single pore (poisson limited). Which is why you see statements like:

The MinION uses a chip that contains ∼2000 robust polymer, rather than lipid bilayer, membranes over microwells that are individually electrically addressed. Assuming a Poisson distribution, a maximum of 37% of the membranes will contain a single nanopore when pores are allowed to insert randomly at the most favorable concentration. [From this paper]

This loses 63% of the system throughput and wastes a significant portion of the chip real-estate. Genia appear to have an at least partial solution to this problem.

The technique is described in a patent (US20140203464 A1) and is really quite simple. I’d guess as with most things the devil is in the details. What they do is take advantage of electroporation, electroporation is  general lab technqiue used to bash holes in cell bilayers to introduce DNA or other chemicals into a cell. From what I’ve read it usually uses 100s of volts.

Genia appear to be using a voltage in the range of 200 to 700mV to weaken the bilayer and promote nanopore insertion. The assumption is (and again, data is somewhat limited) that this relatively large voltage increases the chance of a pore inserting [1].

The pore is I guess constantly attempting to insert into the bilayer with some low probability. The increased bias pushes this probability up significantly. Because Genia have designed their chips with independent control of the biases voltages on each well they can ramp up the bias voltage, check for insertion and if a single pore has inserted reduce the bias and begin detection. They use a relatively low concentration of pores, so that the difference between the probability of inserting in a normal well and one with a high bias voltage is significant.

This seems like a neat approach, and if it really works is quite a nice hack to get round the poisson limit. It’s a technique that should be generally applicable to protein nanopore systems (I assumed they’d need to license from Genia, if the patent holds up).

 

Disclosure/Disclaimer: I have worked and continue to work in the DNA sequencing industry. I own stock in DNA sequencing companies. While I have tried to be unbiased this represents my opinion and speculation only. I recommend reading the publicly available paper for yourself.

[1] 200 to 700mV is significantly higher than the bias generally use for base detection (which is in the 100 to 200mV range).

Relevant section of the patent

For reference, the relevant section of the patent is below:

[0071] In contrast to the self-assembly techniques, the present application discloses an electroporation technique in which an agitation electrical stimulus is applied across the lipid bilayer membrane to disrupt the lipid bilayer and initiate the formation of a nanopore in the lipid bilayer. The concentration of the nanopore forming solution may be readily maintained at a sufficiently low enough level such that no nanopores are inserted automatically into the lipid bilayers. In addition, the agitation electrical stimulus may be applied in such a way that only a single nanopore is inserted into each lipid bilayer.

[0072] Electroporation allows lower amounts (lower concentration) of hemolysin protein in the nanopore forming solution to achieve pore insertions. In some embodiments, the concentration of pore protein is at a level such that when applied to an array of bilayer-covered sensors, less than 10 percent of the bilayers have pores inserted in an uncontrolled manner. Using a lower concentration of pore protein has a number of advantages. For example, a user can have better control of the pore insertion because once a pore is inserted by electroporation, a second pore is unlikely to be inserted by itself. Using a lower concentration of pore protein is more economical. In addition, a lower concentration of pore protein is safer for the user to handle. For example, a high concentration of pore protein spilled on human skin may cause a severe rash, thus posing a health hazard.

[0073] If the electroporation technique described herein is not used, but a solution of protein pores is simply applied to an array of independent bilayers, it is well known to those skilled in the art that the insertion of protein pores into lipid bilayers will follow a Poisson distribution. This independent, randomness in pore insertion over time means that not only pore insertions are uncontrolled but that insertions are independent of prior events and therefore illustrates that more than one pore can be inserted into a single bilayer. Such a random system limits the percentage of single pore instances that one may obtain using concentration of pore protein alone. Changing a nanopore system from a random set of events with a Poisson distribution to a system with active, deterministic pore insertion (not following the Poisson distribution) gives the new system great advantage in attaining a higher percentage of bilayers with single pores.

[0074] The level of the agitation electrical stimulus at which a nanopore is inserted into a lipid bilayer may vary based on various factors, including salt concentration, temperature, the type of lipid membrane material, size of the lipid bilayer, and the like. In some embodiments, about 80-90% of the nanopores are inserted when the magnitude of the agitation electrical stimulus is within the range of 200 mV to 450 mV. The rest of the nanopores may be inserted at lower voltage levels, e.g., 100 mV or at higher levels, e.g., 700 mV.

[0075] In some embodiments, the steps of applying the agitation electrical stimulus, applying the negative stimulus (reverse oxidation stimulus), and applying the measuring electrical stimulus for detecting whether a nanopore has been properly formed are iterated in a loop, until a nanopore is finally formed in the lipid bilayer. Initially, the magnitude of the agitation electrical stimulus is set at a lower level. The magnitude of the agitation electrical stimulus is then gradually increased after each iteration. For example, the initial agitation electrical stimulus may be set at a lower level, such as 60 mV. After each iteration, if a nanopore is still not properly inserted, then the agitation electrical stimulus is adjusted by a small increment, e.g., 2 mV. This process may be repeated until a nanopore is finally inserted into the lipid bilayer, or until the lipid bilayer is damaged or erased by the agitation electrical stimulus, or until the agitation electrical stimulus has reached a predetermined maximum threshold, e.g., 700 mV. By gradually increasing the agitation electrical stimulus level (e.g., from 60 mV to 700 mV) as describe above, a higher percentage of the cells of the nanopore chip will have one nanopore properly inserted into a lipid bilayer.

[0076] In FIG. 5A, agitation electrical stimulus is shown as a positive voltage. However, a negative agitation electrical stimulus may be used in some embodiments as well. When a negative agitation electrical stimulus is used, a positive pulse may be used to reverse any oxidation (e.g., oxidation of the electrodes).

[0077] Because individual pore protein mixes can have smaller or larger percentages of well-formed, active pore molecules, the desired concentration to use for different batches of pore protein varies. In some embodiments, a particular pore protein mix is first tried on a chip to see how active it is and then the concentration is adjusted until application of the mix will put only a few (e.g., 0-10) pores into an array of 264 bilayer covered electrodes without any stimulation. In general, a concentration may be chosen that results in less than about 10 percent pore formation un-stimulated. In some embodiments, a concentration may be chosen that results in less than about 30 percent pore formation un-stimulated. At such a concentration level, an insignificant number of pores will be inserted when the mix is simply left on the array with no stimulation. At this low concentration, electroporation techniques will insert pores between −100 mV and −600 mV. Positive pulses can be used as well.

[0078] In some embodiments, applying concentrations of alpha-hemolysin or MspA pores in the range of 0.1 ng/mL (nanogram) to 2 μg/mL (microgram) of pore protein will typically result in the preferred condition of having only a few pores inserted in a field of 264 bilayer covered electrodes unaided. The exact concentration used may be determined after calibration on a chip and prior to distribution of the protein pore mix to researchers. In such a case, the resulting protein mix is diluted to the optimal level and then stored for future use and distribution to researchers where further calibration is not necessary.

[0079] The amount or concentration needed to reach the desired state described above varies with salt concentration, temperature, pressure, and the dimensions of the bilayers covering the electrodes. Higher temperatures or pressures require lower pore concentration. Larger bilayer diameters also require a lower pore concentration to successfully implement an electroporation scheme for directed, controlled pore insertion. The pore concentrations above take into account possible variations for salt concentrations (KCl or NaCl) (e.g., from 50 mM to 1 M), temperatures (e.g., from 0 degree Celsius to 25 degree Celsius), pressures (e.g., normal barometric pressure at sea level), and bilayer diameters (e.g., from approximately 5 μm to 250 μm). The technique described above of testing a given mix or representative mix allows for these variances to be taken into account.